5  find any word not followed by a specific word

Báo cáo y học: "Tranexamic acid attenuates inflammatory response in cardiopulmonary bypass surgery through blockade of fibrinolysis: a case control study followed by a randomized double-blind controlled trial" doc

Báo cáo y học: "Tranexamic acid attenuates inflammatory response in cardiopulmonary bypass surgery through blockade of fibrinolysis: a case control study followed by a randomized double-blind controlled trial" doc

Ngày tải lên : 13/08/2014, 08:21
... into a logistic regression analysis Results for qualitative variables are expressed as frequency and percentage Quantitative variables are expressed as mean ± standard deviation or as median and ... Coagulation and fibrinolysis determination Quantitative plasminogen activator inhibitor (PAI-1) antigen (normal range: to 47 ng/mL; intra-assay variation: 3.7%) and tissue plasminogen activator ... extracorporeal circuit J Cardiothorac Vasc Anesth 2002, 16:447-451 Marano CW, Garulacan LA, Laughlin KV, Igidbashian L, Trace C, Goldman SM, Sutter FP, Reichard GA Jr, Mullin JM: Plasma concentrations...
  • 10
  • 360
  • 0
seafood processing wastewater treatment by using an activated sludge reactor followed by a cyperusmalaccensis lam. constructed wetland

seafood processing wastewater treatment by using an activated sludge reactor followed by a cyperusmalaccensis lam. constructed wetland

Ngày tải lên : 09/01/2015, 08:53
... et al., 2008)), - Trained maintenance staff or committed users are available who carry out the (simple) maintenance tasks, - Wastewater not too toxic for bacteria and plants, - Adequate quantities ... bamboo (Dracaena sanderiana Hort.) two plants had advantage character are showed in figure 2-3 (a) (b) Figure 2-3 Two species of Limnophila (b) and Cyperus (a) genera Biomass of two plants are ... Higgins et al., 1993; Karathanasis and Thompson, 1995; Bernard and Lauve, 1995) Natural treatment systems have been shown to have a significant capacity for both wastewater treatment and resource...
  • 61
  • 420
  • 0
Tài liệu Giải quyết lỗi “Setup did not find any hard disk drives” khi cài Windows XP ppt

Tài liệu Giải quyết lỗi “Setup did not find any hard disk drives” khi cài Windows XP ppt

Ngày tải lên : 23/12/2013, 18:15
... nén, sau kích Open Việc l a chọn file *.inf không thực quan trọng bạn l a chọn toàn file thư mục nLite đ a thông báo l a chọn driver Nếu xác driver nào, bạn sử dụng Device Manager Vista để tìm ... phần cứng mà bạn sử dụng Chúng ta sử dụng chương trình WinImage Với ví dụ sau, bạn thấy đường dẫn download cho Intel SATA controller driver cho máy tính HP Download chạy file thực thi để giải nén ... Duyệt tới thư mục ch a cài đặt ổ đ a CD, sau kích vào OK c a sổ Browse For Folder Tiếp theo bạn nhận thông báo vị trí muốn lưu lại file tạm sử dụng suốt trình Slip-streaming Trong ví dụ này,...
  • 9
  • 524
  • 1
Tài liệu Giải quyết lỗi “Setup did not find any hard disk drives” khi cài Windows XP pptx

Tài liệu Giải quyết lỗi “Setup did not find any hard disk drives” khi cài Windows XP pptx

Ngày tải lên : 25/01/2014, 02:20
... nén, sau kích Open Việc l a chọn file *.inf không thực quan trọng bạn l a chọn toàn file thư mục nLite đ a thông báo l a chọn driver Nếu xác driver nào, bạn sử dụng Device Manager Vista để tìm ... mục Sau danh sách file mà WinImage điều khiển Chạy WinImage mở file, bạn trông thấy phần nội dung bên Chỉ việc giải nén chúng vào thư mục, tốt nên đặt tên thư mục cho dễ nhớ Trang 2: Tạo đ a XP ... Duyệt tới thư mục ch a cài đặt ổ đ a CD, sau kích vào OK c a sổ Browse For Folder Tiếp theo bạn nhận thông báo vị trí muốn lưu lại file tạm sử dụng suốt trình Slip-streaming Trong ví dụ này,...
  • 8
  • 355
  • 1
Tài liệu Báo cáo khoa học: "Detection of Japanese Homophone Errors by a Decision List Including a Written Word as a Default Evidence" docx

Tài liệu Báo cáo khoa học: "Detection of Japanese Homophone Errors by a Decision List Including a Written Word as a Default Evidence" docx

Ngày tải lên : 22/02/2014, 03:20
... EACL '99 Masahiro Oku and Koji Matsuoka 1997 A Method for Detecting Japanese Homophone Errors in Compound Nouns based on Character Cooccurrence and Its Evaluation (in Japanese) Journal of Natural ... Koji Tochinai, Taisuke Itoh, and Yasuhiro Suzuki 1986 Kana-Kanji Translation System with Automatic Homonym Selection Using Character Chain Matching (in Japanese) Journal of Information Processing, ... increases Our method has an advantage that the size of DL1 is smaller The size of the decision list has no relation to the precision and the recall, but a small decision list has advantages of...
  • 8
  • 588
  • 0
Báo cáo khóa học: Hydrolytic cleavage by a group I intron ribozyme is dependent on RNA structures not important for splicing pot

Báo cáo khóa học: Hydrolytic cleavage by a group I intron ribozyme is dependent on RNA structures not important for splicing pot

Ngày tải lên : 23/03/2014, 12:20
... urea/5% polyacrylamide gels, followed by autoradiography Computations To quantify RNA signals, phosphoimager screens were scanned after one to several days of exposure and the resulting images ... certain receptor motif, but with a significant cross reaction [24,25] Here, GUGA, GUAA and GAAA tetra-loops preferentially interact with CU:AG, CC:GG and a 11 nt motif, respectively To test for a ... order to evaluate the rate of hydrolytic cleavage 17 catalyzed by DiGIR2 and DiGIR2DP9.2, we included the Tetrahymena ribozyme (Tth.L1925) in a comparative Ó FEBS 2004 analysis RNA obtained from...
  • 10
  • 412
  • 2
Báo cáo khoa học: [Na+]i-induced c-Fos expression is not mediated by activation of the 5¢-promoter containing known transcriptional elements ppt

Báo cáo khoa học: [Na+]i-induced c-Fos expression is not mediated by activation of the 5¢-promoter containing known transcriptional elements ppt

Ngày tải lên : 30/03/2014, 08:20
... transferred to a Hybond N+ membrane (Amersham Pharmacia Biotech, ´ Baie d’Urfe, PQ, Canada), UV-immobilized and hybridized to 32P-labeled probes c-Fos mRNA forward (AGG AATAAGATGGCTGCAGCCAAG) and ... Quickchange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA), following the recommendations of the manufacturer, with the sense primer CTCCCCCCTTACACAGGATG TGGATATTACCACATCTGCGTCAGC and ... expression is caused by activation of the Na+i-mediated, Ca2+iindependent signaling pathway It should be noted that the signaling pathways triggered by ouabain are concentration-dependent and cell...
  • 11
  • 449
  • 0
Most cases of STEMI are caused by a thrombotic occlusion of a larger coronary artery (5). The pptx

Most cases of STEMI are caused by a thrombotic occlusion of a larger coronary artery (5). The pptx

Ngày tải lên : 18/06/2014, 12:20
... Practice Guidelines; Canadian Cardiovascular Society ACC/AHA guidelines for the management of patients with ST-elevation myocardial infarction: a report of the American College of Cardiology/American ... Fibrinolysis as a reperfusion treatment has been investigated as a stand-alone therapy, combined with additional earlier or immediate PCI as a so-called “facilitated PCI” strategy, or (under specific ... The pharmacoinvasive treatment strategy is supported by recent registry data (82-84) and study data (85) Facilitated PCI In contrast to pharmacoinvasive therapy, the strategy of facilitated PCI...
  • 12
  • 323
  • 1
Báo cáo hóa học: " Magnetic and Cytotoxicity Properties of La12xSrxMnO3 (0 £ x £ 0.5) Nanoparticles Prepared by a Simple " pptx

Báo cáo hóa học: " Magnetic and Cytotoxicity Properties of La12xSrxMnO3 (0 £ x £ 0.5) Nanoparticles Prepared by a Simple " pptx

Ngày tải lên : 22/06/2014, 00:20
... preparation of manganite nanoparticles, and gives a potential avenue for further practical scale-up of the production process and applications Acknowledgments The authors would like to thank ... of paramagnetic phases of LMO contamination in the samples with x = 0.1 and 0.2 The MS value increases as the Sr content increases and shows the highest value at x = 0.3 and then decreases as ... nm by the plate reader (Biorad, Japan) The average value of four wells was used for each sample and two repeats were done in each experiment The control NIH 3T3 cell viability was defined as 100%...
  • 7
  • 330
  • 0
Báo cáo khoa học: "High-dose chemoradiotherapy followed by surgery versus surgery alone in esophageal cancer: a retrospective cohort study" doc

Báo cáo khoa học: "High-dose chemoradiotherapy followed by surgery versus surgery alone in esophageal cancer: a retrospective cohort study" doc

Ngày tải lên : 09/08/2014, 03:21
... 25 Sasamoto R, Sakai K, Inakoshi H, Sueyama H, Saito M, Sugita T, Tsuchida E, Ito T, Matsumoto Y, Yamanoi T, Abe E, Yamana N, Sasai K: Long-term results of chemoradiotherapy for locally advanced ... the data MH, TWL, AV and KØ assisted in data analysis and interpretation MH, AV, KØ, TWL, ORM and RS assisted in writing the manuscript All authors read and approved the final manuscript Author ... GTV and the radial margin was 1.5 cm in the first phase of treatment (50 Gy) After treatment with 50 Gy the radial, cranial and caudal margins were reduced to cm and additional 16 Gy to a total...
  • 9
  • 213
  • 0
Báo cáo khoa học: " A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low-grade glioma in a teenager: the value of dynamic contrast-enhanced MRI" pptx

Báo cáo khoa học: " A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low-grade glioma in a teenager: the value of dynamic contrast-enhanced MRI" pptx

Ngày tải lên : 09/08/2014, 10:20
... Coefficients, and Image-Guided Histopathology with Special Attention to Radiation Necrosis Neurosurgery 2004, 54:1111-1119 Terakawa Y, Tsuyuguchi N, Iwai Y, Yamanaka K, Higashiyama S, Takami T, Ohata K: ... Spreafico F, Gandola L, Marchiano A, Simonetti F, Poggi G, Adduci A, Clerici CA, Luksch R, Biassoni V, Meazza C, Catania S, Terenziani M, Musumeci R, Fossati-Bellani F, Massimino M: Brain magnetic ... et al.: A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low-grade glioma in a teenager: the value of dynamic contrastenhanced MRI Radiation...
  • 5
  • 425
  • 0
Báo cáo khoa học: " PET/CT Staging Followed by Intensity-Modulated Radiotherapy (IMRT) Improves Treatment Outcome of Locally Advanced Pharyngeal Carcinoma: a matched-pair comparison" pps

Báo cáo khoa học: " PET/CT Staging Followed by Intensity-Modulated Radiotherapy (IMRT) Improves Treatment Outcome of Locally Advanced Pharyngeal Carcinoma: a matched-pair comparison" pps

Ngày tải lên : 09/08/2014, 10:21
... to treatment failure Figure 2a presents Kaplan-Meier curves for time to any treatment failure Time to any treatment failure was analysed by log-rank test The failure-free rate at year was 90% ... patients (100%), a CT of the head and neck, available for 75 patients (87%), PET was available for 16 patients (17%), and MR was available for 12 patients (14%) For extra-regional staging, a CT of the ... similar outcome data reported by others with IMRT alone Furthermore we only analysed locally advanced stages of oro- and hypopharynx carcinomas In how far early AJCC stage II and stage III disease...
  • 10
  • 209
  • 0
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot

báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot

Ngày tải lên : 10/08/2014, 10:21
... Criteria (version 2), clinical laboratory evaluations, and physical examinations OS was calculated from the date of FCR treatment to the date of death from any cause; OS was analyzed by using the Kaplan-Meier ... The authors thank Dr Diana Giannarelli of the Department of Oncology Regina Elena National Cancer Institute for statistical analysis Author details Department of Hematology Regina Elena National ... therapy, may allow more patients, with disseminated disease at diagnosis, to benefit from radioimmunotherapy and may present an attractive treatment option, particulary in older patients (age...
  • 5
  • 287
  • 0
Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf

Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf

Ngày tải lên : 11/08/2014, 03:20
... 174:5390-5397 Suganami T, Tamimoto-Koyama K, Nishida J, Iroh M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/NF- kappa B pathway in saturated ... 6:29-32 Takeda K, Kaisho T, Akira S: Toll-like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi ... monitored on a daily basis All experimental protocols involving animals were approved by the Animal Ethical Committee at Emory University and Georgia State University, Atlanta, GA Tissue harvest and liver...
  • 7
  • 272
  • 0
Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx

Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx

Ngày tải lên : 11/08/2014, 06:22
... 174:5390-5397 Suganami T, Tamimoto-Koyama K, Nishida J, Iroh M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/NF- kappa B pathway in saturated ... 6:29-32 Takeda K, Kaisho T, Akira S: Toll-like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi ... monitored on a daily basis All experimental protocols involving animals were approved by the Animal Ethical Committee at Emory University and Georgia State University, Atlanta, GA Tissue harvest and liver...
  • 7
  • 238
  • 0
Báo cáo y học: " Enteritis caused by Campylobacter jejuni followed by acute motor axonal neuropathy: a case report" pptx

Báo cáo y học: " Enteritis caused by Campylobacter jejuni followed by acute motor axonal neuropathy: a case report" pptx

Ngày tải lên : 11/08/2014, 12:20
... Serbia, had nausea, fever, and had suffered watery diarrhea that lasted for one day The diarrhea was self-limiting and he was treated only with antipyretic drugs Ten days later, he felt muscle weakness ... Ohnishi A, Hayashi S, Takahashi H, Kamijo M, Hirata K: Animal model of axonal Guillain-Barre syndrome induced by sensitization with GM1 ganglioside Ann Neurol 2001, 49:712-720 Apostolski S, Sadiq SA, ... neuropathies and anti-glycolipid antibodies Brain 2002, 125:2591-2625 Nagashima T, Koga M, Odaka M, Hirata K, Yuki N: Continuous spectrum of pharyngeal-cervical-brachial variant of Guillain-Barré...
  • 4
  • 351
  • 0
Báo cáo sinh học: "Decrease in Shiga toxin expression using a minimal inhibitory concentration of rifampicin followed by bactericidal gentamicin treatment enhances survival of Escherichia coli O157: H7-infected BALB/c mice" pdf

Báo cáo sinh học: "Decrease in Shiga toxin expression using a minimal inhibitory concentration of rifampicin followed by bactericidal gentamicin treatment enhances survival of Escherichia coli O157: H7-infected BALB/c mice" pdf

Ngày tải lên : 12/08/2014, 17:20
... 139:102-107 27 Ogawa M, Shimizu K, Nomoto K, Takahashi M, Watanuki M, Tanaka R, Tanaka T, Hamabata T, Yamasaki S, Takeda Y: Protective effect of Lactobacillus casei strain Shirota on Shiga toxin-producing ... Shiga-like Toxins by Antimicrobial Agents: Potential Use in the Treatment of Human Infection J Appl Res 2003, 3:137-143 19 Rahal EA, Kazzi N, Kanbar A, Abdelnoor AM, Matar GM: Role of rifampicin ... described herein and participated in drafting the manuscript AS participated in designing and performing the real-time reversetranscription polymerase chain reaction assays AMA participated in designing...
  • 7
  • 279
  • 0
Báo cáo y học: " Associations between children’s social functioning and physical activity participation are not mediated by social acceptance: a cross-sectional study" ppt

Báo cáo y học: " Associations between children’s social functioning and physical activity participation are not mediated by social acceptance: a cross-sectional study" ppt

Ngày tải lên : 14/08/2014, 08:21
... such associations within the data Although social acceptance was positively associated with both social functioning and PA, mediation analysis revealed that social acceptance did not mediate the ... the associations between social acceptance and the PA variables (path b, Figure 1) was not significant, suggesting that social acceptance did not mediate the peer problems-PA relationship among ... measure among girls Prosocial behaviour displayed a negative association with full day MVPA among girls but was not associated with boys’ PA Social acceptance scores were significantly negatively...
  • 9
  • 244
  • 0
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"

Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"

Ngày tải lên : 25/10/2012, 10:51
... remaining colon wall was normal, but the bowel preparation was poor The invagination of diverticulum has an advantage over diverticulectomy in that it minimizes bowel leakage [15] Moreover, invagination ... which makes its wall weak, as compared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers The vasa recta, which supply the mucosa and submucosa of ... Lawson HH Haemoperitoneum associated with a solitary diverticulum of the sigmoid colon S Afr Med J 1961;35:715-6 Matsagas MI, Fatouros M, Koulouras B, Giannoukas AD Incidence, complications, and...
  • 3
  • 531
  • 0
Báo cáo y học: "Cell Cycle Arrest by a Natural Product via G2/M Checkpoint"

Báo cáo y học: "Cell Cycle Arrest by a Natural Product via G2/M Checkpoint"

Ngày tải lên : 02/11/2012, 11:12
... demonstrated that CKBM is able to inhibit cell proliferation in human gastric cancer cell line, AGS The data from a subcutaneous implantation model of gastric cancer tissue was also agreeable to ... Introduction Pharmaceutical research of traditional Chinese medicines on cancer prevention and treatment has attracted much attention There are a number of herbs that have shown to have the abilities ... 10 PI-Area (15%) 10 PI-Area (15%) PI-Area (15%) Pre-phase 19.5 G1 50.2 S 14.3 G2 35.4 PI-Area (10%) 10 10 PI-Area (15%) PI-Area (15%) Pre-phase 37.4 G1 48.5 S0 G2 51.5 PI-Area (10%) PI-Area (10%)...
  • 6
  • 319
  • 0